← Back
Fetching drawings from USPTO…
The present invention provides, inter alia, methods, pharmaceutical compositions, and kits for treating or ameliorating the effects of a cancer in a subject, which harbors an atypical BRAF mutation (i.e. a non-V600E/K BRAF mutation), comprising an ERK inhibitor. Also provided are methods for identifying a subject having an atypical BRAF mutant cancer who would benefit from therapy comprising an ERK inhibitor.
CROSS REFERENCE TO RELATED APPLICATIONS
The present application is the National Stage of International Application No. PCT/US2018/032755, filed on May 15, 2018, which claims benefit to U.S. Provisional Application No. 62/506,995, filed on May 16, 2017. The entire contents of the above applications are incorporated by reference as if recited in full herein.
FIELD OF THE DISCLOSURE
The present disclosure relates to methods, kits, and pharmaceutical compositions for treating or ameliorating the effects of a cancer with atypical genetic mutations using one or more anti-cancer agents.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING
This application contains references to amino acids and/or nucleic acid sequences that have been filed concurrently herewith as sequence listing text file “1065272.000583-seq.txt”, file size of 254,245 bytes, created on Sep. 11, 2025. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).
BACKGROUND OF THE INVENTION
Mitogen-activated protein kinase (MAPK) or RAS/RAF/MEK/ERK signaling is responsible for several cell signaling pathways involved in control of proliferation, differentiation, and apoptosis. The MAPK cell signaling pathway is found to be disrupted in human cancers, often due to activating mutations of the KRAS, NRAS, or BRAF genes. Selective BRAF inhibitors, such as vemurafenib and dabrafenib, have been developed to target BRAF mutant tumors. For example, vemurafenib is approved for unresectable or metastatic melanomas with BRAF V600E mutation, and detection of the BRAF V600E mutation has become the standard of care for predicting response to vemurafenib, dabrafenib, and trametinib treatment.
While the V600E mutation is the most common BRAF mutation observed in many tumor types, over 100 other mutations within exons 11 and 15 of the BRAF gene have been reported by the Catalog of Somatic Mutations in Cancer (COSMIC) database. The clinical importance of BRAF mutations outside of the V600 codon is largely unknown.
In view of the foregoing, there is a need for novel therapeutic agents that would target the MAPK pathway in cell types harboring BRAF mutations other than V600E. The present application is directed to meeting these and other needs.
SUMMARY OF THE INVENTION
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation, the method comprising administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
According to some embodiments, the ERK inhibitor is BVD-523.
According to some embodiments, the non-V600E/K BRAF mutation is a kinase-activated mutation, a kinase-impaired mutation, or a kinase-unknown mutation, and
According to some embodiments, the kinase-activated mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
According to some embodiments, the kinase-impaired mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
According to some embodiments, the kinase-unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601 delinsE, S605I, Q609L, E611Q, and combinations thereof.
According to some embodiments, the non-V600E/K BRAF mutation is selected from the group consisting of D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 slice variant, and combinations thereof.
According to some embodiments, the subject is a mammal.
According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.
According to some embodiments, the mammal is a human.
According to some embodiments, the cancer is a solid tumor cancer or a hematologic cancer.
According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangio carcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendiceal cancer, squamous cell cancer, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell cancer.
According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of an MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-c-arboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca (SEQ ID NO: 45)) and 523 (cctatcgttagagtcttcctg (SEQ ID NO: 46)) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the HDAC inhibitor is selected from the group consisting of Abexinostat (PCI-24781), Givinostat, Entinostat, Vorinostat, CI-994, CUDC-101, Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of an antibody, antibody fragment, antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla) Cetuximab (Erbitux), bevacizumab (Avastin), Ibritumomab (Zevalin), vedolizumab (Entyvio), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, Ofatumumab, Obinutuzumab (Gazyva) Panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
According to some embodiments, the cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the toxin is diphtheria toxin or portions thereof.
According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
According to some embodiments, the immunomodulator is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune-checkpoint inhibitors, and combinations thereof.
According to some embodiments, the radiosensitizing agent is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.
According to some embodiments, the anti-angiogenesis agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.
According to some embodiments, the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS #32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS #1191951-57-1), P13 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject comprising: (a) identifying a subject with a cancer harboring a non-V600E/K BRAF mutation; and (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
According to some embodiments, the ERK inhibitor is BVD-523.
According to some embodiments, the non-V600E/K BRAF mutation is a kinase-activated mutation, a kinase-impaired mutation, or a kinase-unknown mutation, and combinations thereof.
According to some embodiments, the kinase-activated mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
According to some embodiments, the kinase-impaired mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
According to some embodiments, the kinase-unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.
According to some embodiments, the subject is a mammal.
According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.
According to some embodiments, the mammal is a human.
According to some embodiments, the cancer is a solid tumor cancer or a hematologic cancer.
According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangio carcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendiceal cancer, squamous cell cancer, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell cancer.
According to some embodiments, the method further comprises (i) obtaining a biological sample from the subject; and (ii) screening the sample to determine whether the subject has a non-V600E/K BRAF mutation.
According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of an MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-c-arboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca (SEQ ID NO: 45)) and 523 (cctatcgttagagtcttcctg (SEQ ID NO: 46)) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the HDAC inhibitor is selected from the group consisting of Abexinostat (PCI-24781), Givinostat, Entinostat, Vorinostat, CI-994, CUDC-101 Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the method further comprises administering at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla) Cetuximab (Erbitux), bevacizumab (Avastin), Ibritumomab (Zevalin), vedolizumab (Entyvio), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, Ofatumumab, Obinutuzumab (Gazyva) Panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
According to some embodiments, the cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the toxin is diphtheria toxin or portions thereof.
According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
According to some embodiments, the immunomodulator is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune-checkpoint inhibitors, and combinations thereof.
According to some embodiments, the radiosensitizing agent is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.
According to some embodiments, the anti-angiogenesis agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.
According to some embodiments, the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS #32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
According to one aspect, the present disclosure provides a method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E/K BRAF mutation, wherein the presence of the non-V600E/K BRAF mutation confirms that the subject would benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof.
According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
According to some embodiments, the ERK inhibitor is BVD-523.
According to some embodiments, the non-V600E/K BRAF mutation is a kinase-activated mutation, a kinase-impaired mutation, or a kinase-unknown mutation, and combinations thereof.
According to some embodiments, the kinase-activated mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
According to some embodiments, the kinase-impaired mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
According to some embodiments, the kinase-unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.
According to some embodiments, the subject is a mammal.
According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.
According to some embodiments, the mammal is a human.
According to some embodiments, the cancer is a solid tumor cancer or a hematologic cancer.
According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangio carcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendiceal cancer, squamous cell cancer, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell cancer.
According to some embodiments, the method further comprises administering an ERK inhibitor or a pharmaceutically acceptable salt thereof to a subject having a non-V600E/K BRAF mutation.
According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of an MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-c-arboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca (SEQ ID NO: 45)) and 523 (cctatcgttagagtcttcctg (SEQ ID NO: 46)) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the HDAC inhibitor is selected from the group consisting of Abexinostat (PCI-24781), Givinostat, Entinostat, Vorinostat, CI-994, CUDC-101 Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the method further comprises administering to the subject having a non-V600E/K BRAF mutation at least one additional therapeutic agent selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
According to some embodiments, the antibody or fragment thereof is selected from the group consisting of rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla) Cetuximab (Erbitux), bevacizumab (Avastin), Ibritumomab (Zevalin), vedolizumab (Entyvio), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, Ofatumumab, Obinutuzumab (Gazyva) Panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
According to some embodiments, the cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the toxin is diphtheria toxin or portions thereof.
According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
According to some embodiments, the immunomodulator is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune-checkpoint inhibitors, and combinations thereof.
According to some embodiments, the radiosensitizing agent is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and
According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.
According to some embodiments, the anti-angiogenesis agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.
According to some embodiments, the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS #32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
According to one aspect, the present disclosure provides a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
According to some embodiments, the ERK inhibitor is BVD-523.
According to some embodiments, the non-V600E/K BRAF mutation is a kinase-activated mutation, a kinase-impaired mutation, or a kinase-unknown mutation, and
According to some embodiments, the kinase-activated mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
According to some embodiments, the kinase-impaired mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
According to some embodiments, the kinase-unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601 delinsE, S605I, Q609L, E611Q, and combinations thereof.
According to some embodiments, the subject is a mammal.
According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.
According to some embodiments, the mammal is a human.
According to some embodiments, the cancer is a solid tumor cancer or a hematologic cancer.
According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangio carcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendiceal cancer, squamous cell cancer, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell cancer.
According to some embodiments, the composition is administered to the subject orally or by injection.
According to some embodiments, the composition is administered to the subject as a tablet.
According to some embodiments, the pharmaceutical composition comprises at least one additional therapeutic agent selected from the group consisting of an MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-c-arboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca (SEQ ID NO: 45)) and 523 (cctatcgttagagtcttcctg (SEQ ID NO: 46)) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the HDAC inhibitor is selected from the group consisting of Abexinostat (PCI-24781), Givinostat, Entinostat, Vorinostat, CI-994, CUDC-101 Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla) Cetuximab (Erbitux), bevacizumab (Avastin), Ibritumomab (Zevalin), vedolizumab (Entyvio), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, Ofatumumab, Obinutuzumab (Gazyva) Panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
According to some embodiments, the cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the toxin is diphtheria toxin or portions thereof.
According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
According to some embodiments, the immunomodulator is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune-checkpoint inhibitors, and combinations thereof.
According to some embodiments, the radiosensitizing agent is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.
According to some embodiments, the anti-angiogenesis agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K/Akt pathway.
According to some embodiments, the inhibitor of the PI3K/Akt pathway is selected from the group consisting of A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS #32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS #1191951-57-1), P13 kinase delta inhibitor, Merck KGAA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the pharmaceutical composition is in a unit dosage form comprising both the ERK inhibitor and the additional therapeutic agent.
According to some embodiments, the pharmaceutical composition the ERK inhibitor is in a first unit dosage form and the additional therapeutic agent is in a second unit dosage form, separate from the first.
According to some embodiments, the ERK inhibitor and the additional therapeutic agent are co-administered to the subject.
According to some embodiments, the ERK inhibitor and the additional therapeutic agent are administered to the subject serially.
According to some embodiments, the ERK inhibitor is administered to the subject prior to or subsequent to administration of the additional therapeutic agent.
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation, the method comprising administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject comprising: (a) identifying a subject with a cancer harboring a non-V600E/K BRAF mutation; and (b) administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
According to one aspect, the present disclosure provides a method for identifying a subject having cancer who would benefit from therapy with BVD-523 or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E/K BRAF mutation, wherein the presence of the non-V600E/K BRAF mutation confirms that the subject would benefit from therapy with BVD-523 or a pharmaceutically acceptable salt thereof.
According to one aspect, the present disclosure provides a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
According to one aspect, the present disclosure provides a kit for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation, the kit comprising a pharmaceutical composition disclosed herein, packaged together with instructions for its use.
According to some embodiments, the RAF inhibitor is selected from the group consisting of erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the RAF inhibitor is selected from the group consisting of LXH254 (Novartis), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), REDX0535 (RedX Pharma Plc), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the HDAC inhibitor is selected from the group consisting of Vorinostat, Panobinostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), durvalumab (Imfinzi), Ofatumumab, Obinutuzumab (Gazyva), Panitumumab, and combinations thereof.
According to some embodiments, the inhibitor of the PI3K/Akt pathway is BVD-723.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a schematic of the mitogen-activated protein kinases (MAPK) pathway.
FIG. 2 shows the response in patients treated with BVD-523. Included are all patients with disease measured by RECIST v1.1 who received one dose or greater of study treatment and greater than 1 on-treatment tumor assessment. Response was measured as the change from baseline in the sum of the longest diameter of each target lesion. The solid line indicates the threshold for a partial response according to RECIST v1.1. Abbreviations: GBM, glioblastoma: NSCLC, non-small cell lung cancer: CRC, colorectal cancer. Atypical BRAF mutation associated with each patient's cancer is indicated.
FIG. 3 shows duration of treatment in a Swimmer's plot categorized by group. Members of Group 1 are any patients with any BRAF mutation in any tumor type other than colorectal cancer (CRC) and non-small cell lung carcinoma (NSCLC), and that have not been previously treated with a MAPK pathway inhibitor. The members of Group 2 are patients with any BRAF mutation in CRC that have not been previously treated with a MAPK pathway inhibitor. The members of Group 3 are patients having a tumor with a BRAF V600E/K mutation that is refractory to MAPK inhibitor. The members of Group 6 are patients with any BRAF mutation present in NSCLC. As shown in FIG. 3, all 28 patients are included as represented by the horizontal bars, one for each subject. The duration of treatment for each subject in each group is illustrated from the top (longest treatment duration) to bottom (least treatment duration) of the groups. The horizontal axis represents the duration, in days, that the patient was on the study. FIG. 3 also shows the type of response achieved for each patient according to RECIST v1.1 (diamond=partial response; circle=stable disease; vertical bar=progressive disease; triangle=not evaluated).
FIG. 4 shows duration of treatment in a Swimmer's plot broken down by BRAF mutation. All 28 patients measured for RECIST v1.1 response criteria are included, plus additional patients not evaluated by RECIST v1.1 (diamond=partial response; circle=stable disease; vertical bar=progressive disease; triangle=not evaluated).
DETAILED DESCRIPTION OF THE INVENTION
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation comprising administering to the subject an effective amount of ERK inhibitor or a pharmaceutically acceptable salt thereof.
As used herein, the terms “V600E/K BRAF mutation”, as it related to cancer in a subject, and grammatical variations thereof, means a cancer cell that comprises a nonsynonymous substitution mutation in the gene encoding human BRAF (SEQ ID NO:2) that causes the amino acid valine (V) at amino acid position 600 of BRAF to be substituted by glutamic acid (E) or lysine (K). As used herein, the terms “harboring a non-V600E/K BRAF mutation”, as it relates to a cancer in a subject, and grammatical variations thereof, means that a cancer cell comprises a somatic cell mutation that is not a V600E/K BRAF mutation. As used herein, all BRAF mutations are based on the human wild-type sequence (SEQ ID NO: 2). Orthologs thereof from other species are also contemplated herein.
As used herein, the terms “treat,” “treating,” “treatment” and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present invention may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population may fail to respond or respond inadequately to treatment.
As used herein, the terms “ameliorate”, “ameliorating” and grammatical variations thereof mean to decrease the severity of the symptoms of a disease in a subject.
As used herein, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.
As used herein, the term an “effective amount” or a “therapeutically effective amount” of a compound or composition disclosed herein is an amount of such compound or composition that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of mammal, e.g., human patient, and like factors well known in the arts of medicine and veterinary medicine. In general, a suitable dose of a compound or composition according to the invention will be that amount of the composition, which is the lowest dose effective to produce the desired effect. The effective dose of a compound or composition of the present invention may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. According to some embodiments, the ERK inhibitor is BVD-523.
In the present invention, BVD-523 is a compound according to formula (I):
and pharmaceutically acceptable salts thereof. BVD-523 is a highly potent, selective, reversible, ATP-competitive ERK1/2 inhibitor. BVD-523 may be synthesized according to the methods disclosed in, e.g., U.S. Pat. No. 7,354,939, which is incorporated by reference. Enantiomers and racemic mixtures of both enantiomers of BVD-523 are also contemplated within the scope of the present invention. BVD-523 is an ERK1/2 inhibitor with a mechanism of action that is believed to be, e.g., unique and distinct from certain other ERK1/2 inhibitors, such as SCH772984. For example, other ERK1/2 inhibitors, such as SCH772984, inhibit autophosphorylation of ERK (Morris et al., 2013), whereas BVD-523 allows for the autophosphorylation of ERK while still inhibiting ERK.
According to some embodiments, the subject's cancer has a somatic mutation in the BRAF gene. As used herein, “somatic mutation” means a change occurring in any cell that is not destined to become a germ cell. The mutation may be, e.g., a substitution, deletion, insertion, or a fusion. Table 1 below shows a distribution overview of BRAF mutations, as shown in the Sanger database.
TABLE 1
Distribution overview of BRAF mutations
Mutation Type
Mutant samples
Percentage
Substitution nonsense
23
0.07
Substitution missense
32955
99.07
Substitution synonymous
80
0.24
Insertion inframe
25
0.08
Insertion frameshift
1
0.00
Deletion inframe
13
0.04
Deletion frameshift
5
0.02
Complex
39
0.12
Other
172
0.52
Total
33263
100
BRAF mutations are found in approximately 66% melanoma (Davies et al., 2002; Brose et al., 2002; Hocket et al., 2007), and a relatively lower percentage in other cancers, 36% thyroid tumors and 10% colon cancers (Xu et al., 2003; Fransen et al., 2004). The most prevalent BRAF mutation occurs at amino acid 600 of the human wild-type protein kinase (SEQ ID NO:2) by substituting valine with glutamic acid resulting in the mutant B-RafV600E, which accounts for about 80% of BRAF mutations (Davies et al., 2002; Hocker et al., 2007). B-RafV600E kinase domain has 500-fold higher kinase activity compared to the basal activity of wild-type B-Raf (Wan et al., 2004). Of the other BRAF mutations identified in melanoma, V600K and V600D/R are also common and represent 16% and 3% of all BRAF mutations, respectively (Long et al., 2011). In addition to melanoma, BRAF mutations are also common in many other cancers including papillary thyroid carcinoma, ovarian carcinoma, and colorectal carcinoma. (Wellbrock et al., 2004). In one study, BRAF splice variants (splicing out exons 14 and 15) were found in 5/24 (21%) colorectal cancers cell lines (Seth et al., 2009).
Table 2 below from the Sanger database shows the distribution and frequency of BRAF mutations in human tumors.
TABLE 2
Unique Mutated
Total Unique
%
Primary Tissue
Samples
Samples
Mutated
NS
1071
1788
59.90
Adrenal gland
3
155
1.94
Autonomic ganglia
3
703
0.43
Biliary tract
36
684
5.26
Bone
5
284
1.76
Breast
27
2297
1.18
Central nervous
206
3297
6.25
system
Cervix
6
473
1.27
Endometrium
40
2510
1.59
Eye
70
732
9.56
Fallopian tube
0
2
0
Gastrointestinal tract
5
514
0.97
(site indeterminate)
Genital tract
4
54
7.41
Haematopoietic and
507
5388
9.41
lymphoid tissue
Kidney
34
959
3.55
Large intestine
8301
67530
12.29
Liver
18
618
2.91
Lung
293
11249
2.60
Meninges
0
74
0
Oesophagus
5
927
0.54
Ovary
312
3922
7.96
Pancreas
16
1089
1.47
Parathyroid
0
20
0
Penis
0
28
0
Peritoneum
0
37
0
Pituitary
1
115
0.87
Placenta
0
2
0
Pleura
3
148
2.03
Prostate
25
1483
1.69
Salivary gland
1
131
0.76
Skin
7245
16943
42.76
Small intestine
12
251
4.78
Soft tissue
45
2160
2.08
Stomach
11
1473
0.75
Testis
7
251
2.79
Thymus
0
50
0
Thyroid
14929
38002
39.28
Upper aerodigestive
14
1352
1.04
tract
Urinary tract
8
612
1.31
Vagina
0
1
0
Vuvla
0
3
0
Total
33263
168311
19.76
Table 3 below shows select nucleic acid and amino acid sequences of BRAF. These sequences may be used in methods for identifying subjects with a mutant BRAF genotype (such as in the methods set forth below).
TABLE 3
Nucleic acid or
Other
SEQ ID NO
polypeptide
Organism
information
1
nucleic acid
human
2
polypeptide
human
3
nucleic acid
rat (Rattus norvegicus)
4
polypeptide
rat (Rattus norvegicus)
5
nucleic acid
mouse, Mus musculus
6
polypeptide
mouse, Mus musculus
7
nucleic acid
rabbit, Oryctolagus
cuniculus
8
polypeptide
rabbit, Oryctolagus
cuniculus
9
nucleic acid
guinea pig, Cavia
porcellus
10
polypeptide
guinea pig, Cavia
porcellus
11
nucleic acid
dog, Canis lups
variant x1
familiaris
12
polypeptide
dog, Canis lups
variant x1
familiaris
13
nucleic acid
dog, Canis lups
variant x2
familiaris
14
polypeptide
dog, Canis lups
variant x2
familiaris
15
nucleic acid
cat, Felis catus
16
polypeptide
cat, Felis catus
17
nucleic acid
cow, Bos taurus
variant X1
18
polypeptide
cow, Bos taurus
variant X1
19
nucleic acid
cow, Bos taurus
variant X2
20
polypeptide
cow, Bos taurus
variant X2
21
nucleic acid
cow, Bos taurus
variant X3
22
polypeptide
cow, Bos taurus
variant X3
23
nucleic acid
cow, Bos taurus
variant X4
24
polypeptide
cow, Bos taurus
variant X4
25
nucleic acid
cow, Bos taurus
variant X5
26
polypeptide
cow, Bos taurus
variant X5
27
nucleic acid
cow, Bos taurus
variant X6
28
polypeptide
cow, Bos taurus
variant X6
29
nucleic acid
cow, Bos taurus
variant X7
30
polypeptide
cow, Bos taurus
variant X7
31
nucleic acid
cow, Bos taurus
variant X8
32
polypeptide
cow, Bos taurus
variant X8
33
nucleic acid
cow, Bos taurus
variant X9
34
polypeptide
cow, Bos taurus
variant X9
35
nucleic acid
cow, Bos taurus
variant X10
36
polypeptide
cow, Bos taurus
variant X10
37
nucleic acid
cow, Bos taurus
variant X11
38
polypeptide
cow, Bos taurus
variant X11
39
nucleic acid
cow, Bos taurus
variant 2
40
polypeptide
cow, Bos taurus
variant 2
41
nucleic acid
horse, Equus caballus
42
polypeptide
horse, Equus caballus
43
nucleic acid
chicken, Gallus gallus
44
polypeptide
chicken, Gallus gallus
Methods for identifying mutations in nucleic acids, such as the above identified BRAF genes, are known in the art. Nucleic acids may be obtained from biological samples. In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from a subject by routine procedures and methods which are known in the art.
Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probes, fluorescent in situ hybridization (FISH) assays, and combinations thereof.
Various sequencing methods are known in the art. These include, but are not limited to, Sanger sequencing (also referred to as dideoxy sequencing) and various sequencing-by-synthesis (SBS) methods as disclosed in, e.g., Metzker 2005, sequencing by hybridization, by ligation (for example, WO 2005021786), by degradation (for example, U.S. Pat. Nos. 5,622,824 and 6,140,053) and nanopore sequencing (which is commercially available from Oxford Nanopore Technologies, UK). In deep sequencing techniques, a given nucleotide in the sequence is read more than once during the sequencing process. Deep sequencing techniques are disclosed in e.g., U.S. Patent Publication No. 20120264632 and International Patent Publication No. WO2012125848.
The PCR-based methods for detecting mutations are known in the art and employ PCR amplification, where each target sequence in the sample has a corresponding pair of unique, sequence-specific primers. For example, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows for rapid detection of mutations after the genomic sequences are amplified by PCR. The mutation is discriminated by digestion with specific restriction endonucleases and is identified by electrophoresis. See, e.g., Ota et al., 2007. Mutations may also be detected using real time PCR. See, e.g., International Application publication No. WO2012046981.
Hybrid capture methods are known in the art and are disclosed in, e.g., U.S. Patent Publication No. 20130203632 and U.S. Pat. Nos. 8,389,219 and 8,288,520. These methods are based on the selective hybridization of the target genomic regions to user-designed oligonucleotides. The hybridization can be to oligonucleotides immobilized on high or low density microarrays (on-array capture), or solution-phase hybridization to oligonucleotides modified with a ligand (e.g. biotin) which can subsequently be immobilized to a solid surface, such as a bead (in-solution capture).
Molecular Inversion Probe (MIP) methods are known in the art and are disclosed in e.g., Absalan et al., 2008. Such methods use MIP molecules, which are special “padlock” probes (Nilsson et al., 1994) for genotyping. A MIP molecule is a linear oligonucleotide that contains specific regions, universal sequences, restriction sites and a Tag (index) sequence (16-22 bp). In such methods, a MIP hybridizes directly around the genetic marker/SNP of interest. The MIP method may also use a number of “padlock” probe sets that hybridize to genomic DNA in parallel (Hardenbol et al., 2003). In case of a perfect match, genomic homology regions are ligated by undergoing an inversion in configuration (as suggested by the name of the technique) and creating a circular molecule. After the first restriction, all molecules are amplified with universal primers. Amplicons are restricted again to ensure short fragments for hybridization on a microarray. Generated short fragments are labeled and, through a Tag sequence, hybridized to a cTag (complementary strand for index) on an array. After the formation of a Tag-cTag duplex, a signal is detected.
According to some embodiments, the non-V600E/K BRAF mutation is a kinase-activated mutation, a kinase-impaired mutation, a kinase-unknown mutation, and combinations thereof. As used herein, the term “kinase-activated mutation”, and grammatical variations thereof, means that a mutation causes elevation of the kinase activity of the mutated kinase relative to the wild-type kinase. As used herein, the term “kinase-impaired mutation”, and grammatical variations thereof, means that a mutation causes a decrease in the kinase activity of the mutated kinase relative to the wild-type kinase. As used herein, the term “kinase-unknown mutation”, and grammatical variations thereof, means that the activity of the mutant kinase is not known or that the activity of the mutated kinase is approximately equivalent to the kinase activity of the wild-type kinase. (See Zheng, G., et al., Clinical detection and categorization of uncommon and concomitant mutations involving BRAF, BMC Cancer, (2015) 15:779, incorporated by reference herein in its entirety)
According to some embodiments, the BRAF kinase-activated mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. According to some embodiments, the BRAF kinase-impaired mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. According to some embodiments, the BRAF kinase-unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof. As used herein all BRAF mutations are based on the human wild-type sequence (SEQ ID NO: 2). Orthologs thereof from other species are also contemplated herein.
In the present invention, the method and composition for treating non-V600E/K BRAF mutations are effective against disease states that harbor a single mutation and one or more mutations. Indeed, any single mutations or any combination of mutations disclosed herein (or hereinafter identified) may be treated with the compositions or according to the methods of the present invention (e.g., any combination of non-V600E/K mutation or any combination of non-V600E/K mutation with a V600E/K mutation).
According to some embodiments, the non-V600E/K BRAF mutation is selected from the group consisting of D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 slice variant, and
As used herein, the notation for the amino acid substitution mutation comprises the closed format of: wild-type amino acid; position; substituted amino acid (e.g., K601E). As used herein, the notation for amino acid substitution also comprises the open ended format of: wild-type amino acid; position (e.g., G469). As used herein, the open ended notation comprises substitutions of any amino acid. For example, the G469 mutation discloses a substitution of glycine at position 469 by any of amino acids A, R, N, D, C, Q, E, H, I, L, K, M, F, P, S, T, W, Y, V. Also as used herein, the closed notation comprises substitutions by any amino acid, and preferably the stated substituted amino acid. For example, the K601E mutation discloses a substitution of lysine at position 601 by any of amino acids A, R, N, D, C, Q, E, G, H, I, L, M, F, P, S, T, W, Y, V, and more preferably by amino acid E. The use of a closed notation, as used herein, should not be construed as limiting the disclosure to the specifically stated amino acid substitution.
According to some embodiments, the subject comprising the cancer harboring the non-V600E/K BRAF mutation is a mammal. According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals. According to some embodiments, the mammal is a human.
According to some aspects, the present disclosure provides both solid and hematologic cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumor, gestational trophoblastic tumor, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, large intestine cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver tumor/cancer, lung tumor/cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasm, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell cancer, transitional cell cancer of the renal pelvis and ureter, salivary gland cancer, Sezary syndrome, skin cancers (such as cutaneous t-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.
Examples of hematologic cancers include, but are not limited to, leukemias, such as adult/childhood acute lymphoblastic leukemia, adult/childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia, lymphomas, such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult/childhood Hodgkin lymphoma, mycosis fungoides, adult/childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sezary syndrome, cutaneous T-cell lymphoma, and Waldenstrom macroglobulinemia, as well as other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma/plasma cell neoplasm, myelodysplastic syndromes, and myelodysplastic/myeloproliferative neoplasms.
According to some embodiments, the subject's cancer is selected from the group consisting of glioblastoma, melanoma, cholangio carcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendiceal cancer, squamous cell cancer, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer. Preferably, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell cancer.
According to some aspects, the present disclosure provides administering to the subject at least one additional mitogen-activated protein kinase (MAPK) pathway inhibitor. According to some embodiments, the at least one additional therapeutic agent is selected from the group consisting of an MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, an ERK inhibitor, and combinations thereof.
As used herein, a “mitogen-activated protein kinase (MAPK) pathway inhibitor” is any substance that modulates, for example reduces, the activity, expression or phosphorylation of proteins in the MAPK pathway that result in a reduction of cell growth or an increase in cell death.
An overview of the mammalian MAPK cascades is shown in FIG. 1. The details of the MAPK pathways are reviewed in e.g., Akinleye et al., 2013. Briefly, with respect to the ERK1/2 module in FIG. 1 (light purple box), the MAPK 1/2 signaling cascade is activated by ligand binding to receptor tyrosine kinases (RTK). The activated receptors recruit and phosphorylate adaptor proteins Grb2 and SOS, which then interact with membrane-bound GTPase Ras and cause its activation. In its activated GTP-bound form, Ras recruits and activates Raf kinases (A-Raf, B-Raf, and C-Raf/RaF-1). The activated Raf kinases activate MAPK 1/2 (MKK1/2), which in turn catalyzes the phosphorylation of threonine and tyrosine residues in the activation sequence Thr-Glu-Tyr of ERK1/2. With respect to the JNK/p38 module (yellow box in FIG. 1), upstream kinases, MAP3Ks, such as MEKK1/4, ASK1/2, and MLK1/2/3, activate MAP2K3/6 (MKK3/6), MAP2K4 (MKK4), and MAP2K7 (MKK7). These MAP2Ks then activate JNK protein kinases, including JNK1, JNK2, and JNK3, as well as p38 α/β/γ/Δ. To execute their functions, JNKs activate several transcription factors, including c-Jun, ATF-2, NF-ATc1, HSF-1 and STAT3. With respect to the ERK5 module (blue box in FIG. 1), the kinases upstream of MAP2K5 (MKK5) are MEKK2 and MEKK3. The best characterized downstream target of MEK5 is ERK5, also known as big MAP kinase 1 (BMK1) because it is twice the size of other MAPKs.
Non-limiting examples of MAPK pathway inhibitors include RAS inhibitors, RAF inhibitors, MEK inhibitors, ERK1/2 inhibitors, pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “RAS inhibitor” means those substances that (i) directly interact with RAS, e.g., by binding to RAS and (ii) decrease the expression or the activity of RAS. Non-limiting exemplary RAS inhibitors include, but are not limited to, farnesyl transferase inhibitors (such as, e.g., tipifarnib and lonafamib), farnesyl group-containing small molecules (such as, e.g., salirasib and TLN-4601), DCAI, as disclosed by Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602, as disclosed by Shima (Shima et al., 2013), HBS 3 (Patgiri et al., 2011), and AIK-4 (Allinky).
As used herein, a “RAF inhibitor” means those substances that (i) directly interact with RAF, e.g., by binding to RAF and (ii) decrease the expression or the activity of RAF, such as, e.g., A-RAF, B-RAF, and C-RAF (Raf-1). Non-limiting exemplary RAF inhibitors include:
AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca (SEQ ID NO: 45)) and 523 (cctatcgttagagtcttcctg (SEQ ID NO: 46)) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, RAF inhibitors include pan-inhibitors; non-limiting examples of which include erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent) pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “MEK inhibitor” means those substances that (i) directly interact with MEK, e.g., by binding to MEK and (ii) decrease the expression or the activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention. Non-limiting examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-c-arboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, an “ERK1/2 inhibitor” means those substances that (i) directly interact with ERK1 and/or ERK2, e.g., by binding to ERK1/2 and (ii) decrease the expression or the activity of ERK1 and/or ERK2 protein kinases. Therefore, inhibitors that act upstream of ERK1/2, such as MEK inhibitors and RAF inhibitors, are not ERK1/2 inhibitors according to the present invention. Non-limiting examples of an ERK1/2 inhibitor include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, an “HDAC inhibitor” means those substances that (i) directly interact with a histone deacetylase (HDAC), e.g., by binding to HDAC, and (ii) decrease the expression or activity of the HDAC. Non-limiting examples of HDAC inhibitors include Abexinostat (PCI-24781), Givinostat, Entinostat, Vorinostat, CI-994, CUDC-101 Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
According to some embodiments, the HDAC inhibitor is selected from the group consisting of Vorinostat, Panobinostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
In another aspect, the method further comprises administering to the subject at least one additional therapeutic agent effective for treating or ameliorating the effects of the cancer. The additional therapeutic agent may be selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
As used herein, an “antibody” encompasses naturally occurring immunoglobulins as well as non-naturally occurring immunoglobulins, including, for example, single chain antibodies, chimeric antibodies (e.g., humanized murine antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Fragments of antibodies include those that bind antigen, (e.g., Fab′, F(ab′)2, Fab, Fv, and rIgG). See also, e.g., Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term “antibody” further includes both polyclonal and monoclonal antibodies.
Examples of therapeutic antibodies that may be used in the present invention include rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla), Cetuximab (Erbitux), bevacizumab (Avastin), Ibritumomab (Zevalin), vedolizumab (Entyvio), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, Ofatumumab, Obinutuzumab (Gazyva) Panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), Brentuximab Vedotin (Adcetriz), Ado-trastuzumab emtansine (Kadcyla), Ipilimumab (Yervoy), Nivolumab (Opdivo), pembrolizumab (Keytruda), Alemtuzamab atezolizumab (Tecentriq), durvalumab (Imfinzi), Ofatumumab, Obinutuzumab (Gazyva) Panitumumab, and combinations thereof.
Cytotoxic agents according to the present invention include DNA damaging agents, antimetabolites, anti-microtubule agents, antibiotic agents, etc. DNA damaging agents include alkylating agents, platinum-based agents, intercalating agents, and inhibitors of DNA replication. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of inhibitors of DNA replication include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimetabolites include folate antagonists such as methotrexate and premetrexed, purine antagonists such as 6-mercaptopurine, dacarbazine, and fludarabine, and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Anti-microtubule agents include without limitation vinca alkaloids, paclitaxel (Taxol®), docetaxel (TaxotereR), and ixabepilone (Ixempra®). Antibiotic agents include without limitation actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to some embodiments, the cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
Cytotoxic agents according to the present invention also include an inhibitor of the PI3K/Akt pathway. Non-limiting examples of an inhibitor of the PI3K/Akt pathway include A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
In the present invention, BVD-723 is a compound according to formula (II):
and pharmaceutically acceptable salts thereof. BVD-723 is a selective inhibitor of PI3Kγ. BVD-723 may be synthesized according to the methods disclosed in, e.g., U.S. Pub. No. 2016/0214980, which is incorporated herein by reference in its entirety. Enantiomers and racemic mixtures of both enantiomers of BVD-723 are also contemplated within the scope of the present invention.
In the present invention, the term “toxin” means an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or portions thereof.
In the present invention, the term “radionuclide” means a radioactive substance administered to the patient, e.g., intravenously or orally, after which it penetrates via the patient's normal metabolism into the target organ or tissue, where it delivers local radiation for a short time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.
In the present invention, the term “immunomodulator” means a substance that alters the immune response by augmenting or reducing the ability of the immune system to produce antibodies or sensitized cells that recognize and react with the antigen that initiated their production. Immunomodulators may be recombinant, synthetic, or natural preparations and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunomodulators are naturally present in the body, and certain of these are available in pharmacologic preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune-checkpoint inhibitors, and combinations thereof.
In the present invention, the term “photoactive therapeutic agent” means compounds and compositions that become active upon exposure to light. Certain examples of photoactive therapeutic agents are disclosed, e.g., in U.S. Patent Application Serial No. 2011/0152230 A1, “Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy.”
In the present invention, the term “radiosensitizing agent” means a compound that makes tumor cells more sensitive to radiation therapy. Examples of radiosensitizing agents include misonidazole, metronidazole, tirapazamine, and trans sodium crocetinate, and combination thereof.
In the present invention, the term “hormone” means a substance released by cells in one part of a body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerianormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.
Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the meaning of hormone in the present invention.
As used herein, an “anti-angiogenesis” agent means a substance that reduces or inhibits the growth of new blood vessels, such as, e.g., an inhibitor of vascular endothelial growth factor (VEGF) and an inhibitor of endothelial cell migration. Anti-angiogenesis agents include without limitation 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject comprising (a) identifying a subject with a cancer harboring a non-V600E/K BRAF mutation; and (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
According to one embodiment, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. According to one embodiment, the ERK inhibitor is BVD-523. In one aspect of this embodiment, the BVD-523 or a pharmaceutically acceptable salt thereof is administered in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or diluent.
According to one aspect, the present disclosure provides identifying a subject with a cancer harboring a non-V600E/K BRAF mutation comprising (i) obtaining a biological sample from the subject; and (ii) screening the sample to determine whether the subject has a non-V600E/K BRAF mutation.
Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified above. Methods of identifying such mutations are also as set forth above.
In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from a subject by routine procedures and methods which are known in the art. Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probes, fluorescent in situ hybridization (FISH) assays, and
According to one embodiment, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of an MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof. Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified above, using one or more of the additional therapeutic agents disclosed above. Methods of identifying such mutations are also as set forth above.
According to one aspect, the present disclosure provides a method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof, the method comprising (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E/K BRAF mutation, wherein the presence of the non-V600E/K BRAF mutation confirms that the subject would benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof. According to some embodiments, the method further comprises administering an ERK inhibitor to the subject or a pharmaceutically acceptable salt thereof. According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent. In this embodiment, the method may be used to identify the mutational background identified above in the cancers described above. The methods of identifying such mutations are also as set forth above. In this embodiment, the ERK inhibitor that the identified patient would benefit from is as described above. Additional therapeutic agents are as disclosed above. Suitable and preferred subjects are as disclosed above.
According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of a cancer in a subject comprising (a) identifying a subject with a cancer harboring a non-V600E/K BRAF mutation; and (b) administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof. According to one aspect, the present disclosure provides a method for identifying a subject having cancer who would benefit from therapy with BVD-523 or a pharmaceutically acceptable salt thereof, the method comprising (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E/K BRAF mutation, wherein the presence of the non-V600E/K BRAF mutation confirms that the subject would benefit from therapy with BVD-523 or a pharmaceutically acceptable salt thereof. In these embodiments, the method may be used to identify the mutational background identified above in the cancers described above. The methods of identifying such mutations are also as set forth above. Suitable and preferred subjects are as disclosed above.
A further aspect of the present disclosure provides a kit for treating or ameliorating the effects of a cancer in a subject harboring a non-V600E/K BRAF mutation. According to some embodiments, the kit comprises an effective amount of an ERK inhibitor as described above, and optionally an additional therapeutic agent as described above.
The kits may also include suitable storage containers, e.g., ampules, vials, tubes, etc., for each anti-cancer agent of the present invention (which may e.g., may be in the form of pharmaceutical compositions) and other reagents, e.g., buffers, balanced salt solutions, etc., for use in administering the anti-cancer agents to subjects. The anti-cancer agents of the invention and other reagents may be present in the kits in any convenient form, such as, e.g., in a solution or in a powder form. The kits may further include a packaging container, optionally having one or more partitions for housing the pharmaceutical composition and other optional reagents.
In the present invention, an “effective amount” or a “therapeutically effective amount” of an anti-cancer agent of the invention including pharmaceutical compositions containing same that are disclosed herein is an amount of such agent or composition that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of mammal, e.g., human patient, and like factors well known in the arts of medicine and veterinary medicine. In general, a suitable dose of an agent or composition according to the invention will be that amount of the agent or composition, which is the lowest dose effective to produce the desired effect. The effective dose of an agent or composition of the present invention may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
A suitable, non-limiting example of a dosage of BVD-523, a RAF inhibitor, an ERK inhibitor, or another anti-cancer agent disclosed herein is from about 1 mg/kg to about 2400 mg/kg per day, such as from about 1 mg/kg to about 1200 mg/kg per day, 75 mg/kg per day to about 300 mg/kg per day, including from about 1 mg/kg to about 100 mg/kg per day. Other representative dosages of such agents include about 1 mg/kg. 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 75 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 250 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, 1000 mg/kg, 1100 mg/kg, 1200 mg/kg, 1300 mg/kg, 1400 mg/kg, 1500 mg/kg, 1600 mg/kg, 1700 mg/kg, 1800 mg/kg, 1900 mg/kg, 2000 mg/kg, 2100 mg/kg, 2200 mg/kg, and 2300 mg/kg per day. The effective dose of BVD-523, RAF inhibitors, ERK inhibitors, or other anti-cancer agents disclosed herein may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
The BVD-523, RAF inhibitors, ERK inhibitors, or other therapeutic agents or pharmaceutical compositions containing same of the present invention may be administered in any desired and effective manner: for oral ingestion, or as an ointment or drop for local administration to the eyes, or for parenteral or other administration in any appropriate manner such as intraperitoneal, intratumoral, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. Further, the BVD-523, RAF inhibitors or other therapeutic agents or pharmaceutical compositions containing same of the present invention may be administered in conjunction with other treatments. The BVD-523, RAF inhibitors or other therapeutic agents or pharmaceutical compositions containing the same may be encapsulated or otherwise protected against gastric or other secretions, if desired.
The pharmaceutical compositions of the invention comprise one or more active ingredients, e.g. therapeutic agents, in admixture with one or more pharmaceutically-acceptable diluents or carriers and, optionally, one or more other compounds, drugs, ingredients and/or materials. Regardless of the route of administration selected, the agents/compounds of the present invention are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art. See, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.).
Pharmaceutically acceptable diluents or carriers are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.) and The National Formulary (American Pharmaceutical Association, Washington, D.C.)) and include sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and tryglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and groundnut), cocoa butter, waxes (e.g., suppository waxes), paraffins, silicones, talc, silicylate, etc. Each pharmaceutically acceptable diluent or carrier used in a pharmaceutical composition of the invention must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a chosen dosage form and method of administration can be determined using ordinary skill in the art.
The pharmaceutical compositions of the invention may, optionally, contain additional ingredients and/or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, hydroxypropylmethyl cellulose, sucrose and acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethyl cellulose and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth; (11) buffering agents; (12) excipients, such as lactose, milk sugars, polyethylene glycols, animal and vegetable fats, oils, waxes, paraffins, cocoa butter, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonites, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicates, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surface-active agents; (16) dispersing agents; (17) control-release or absorption-delaying agents, such as hydroxypropylmethyl cellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents; (22), solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents which render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweetening, flavoring, coloring, perfuming and preservative agents. Each such ingredient or material must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a chosen dosage form and method of administration may be determined using ordinary skill in the art.
The pharmaceutical compositions of the present invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, powders, granules, a solution or a suspension in an aqueous or non-aqueous liquid, an oil-in-water or water-in-oil liquid emulsion, an elixir or syrup, a pastille, a bolus, an electuary or a paste. These formulations may be prepared by methods known in the art, e.g., by means of conventional pan-coating, mixing, granulation or lyophilization processes.
Solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like) may be prepared, e.g., by mixing the active ingredient(s) with one or more pharmaceutically-acceptable diluents or carriers and, optionally, one or more fillers, extenders, binders, humectants, disintegrating agents, solution retarding agents, absorption accelerators, wetting agents, absorbents, lubricants, and/or coloring agents. Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using a suitable excipient. A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using a suitable binder, lubricant, inert diluent, preservative, disintegrant, surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine. The tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein. They may be sterilized by, for example, filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of a composition such that they release the active ingredient only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. The active ingredient can also be in microencapsulated form.
Liquid dosage forms for oral administration include pharmaceutically-acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. The liquid dosage forms may contain suitable inert diluents commonly used in the art. Besides inert diluents, the oral compositions may also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents. Suspensions may contain suspending agents.
The pharmaceutical compositions of the present invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more active ingredient(s) with one or more suitable nonirritating diluents or carriers which are solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound. The pharmaceutical compositions of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such pharmaceutically-acceptable diluents or carriers as are known in the art to be appropriate.
Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants. The active agent(s)/compound(s) may be mixed under sterile conditions with a suitable pharmaceutically-acceptable diluent or carrier. The ointments, pastes, creams and gels may contain excipients. Powders and sprays may contain excipients and propellants.
The pharmaceutical compositions of the present invention suitable for parenteral administrations may comprise one or more agent(s)/compound(s) in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain suitable antioxidants, buffers, solutes which render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants, such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption.
In some cases, in order to prolong the effect of a drug (e.g., pharmaceutical formulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility.
The rate of absorption of the active agent/drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered agent/drug may be accomplished by dissolving or suspending the active agent/drug in an oil vehicle. Injectable depot forms may be made by forming microencapsule matrices of the active ingredient in biodegradable polymers. Depending on the ratio of the active ingredient to polymer, and the nature of the particular polymer employed, the rate of active ingredient release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue. The injectable materials can be sterilized for example, by filtration through a bacterial-retaining filter.
The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and may be stored in a lyophilized condition requiring only the addition of the sterile liquid diluent or carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above.
The following examples are provided to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.
Example 1
The following example shows the results of the solid tumor Phase 1b trial of BVD-523. The waterfall plot depicted in FIG. 2 provides an illustration of human clinical trial patient information showing each individual patient's response to treatment with BVD-523, as measured by % change in tumor burden. Patients generally received 600 mg, twice daily (BID), with some patients receiving a deescalated dose of 300 mg-400 mg BID if side effects were not manageable with other palliative medication.
As shown in FIG. 2, tumor response to BVD-523 was assessed in 28 evaluable patients using Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST v1.1). One patient did not receive both scans of target lesions and was thus not evaluated. The horizontal axis across the plot serves as a baseline measurement for each patient. The vertical axis is a measure of the maximum percentage change from baseline; i.e., percent growth or reduction of tumor burden by radiologic measurement according to RECIST v1.1. Radiologic measurement comprised computed tomography (CT) scan and, rarely, magnetic resonance imaging (MRI).
The tumor burden data represented by FIG. 2 is arranged from the worst value (i.e. greatest progression of tumor burden) on the left side of the plot to the best value (i.e., greatest reduction of tumor burden) on the right side of the plot. RECIST v1.1 response criteria for measured target lesions have been described previously. (See Eisenhauer, E. A., et al., New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1), European J. of Cancer 45, 228-247 (2009), incorporated by reference herein in its entirety). The response criteria is as follows:
Complete Response (CR)—disappearance of all target lesions;
Partial Response (PR)—at least a 30% decrease in the sum of diameters of target lesions, taking as reference the baseline sum diameters; as shown in FIG. 2, the 30% decrease threshold for partial response is indicated by horizontal line;
Progressive Disease (PD)—at least a 20% increase in the sum of diameters of target lesions, taking as reference the smallest sum on study (this includes the baseline sum if that is the smallest on study). In addition to the relative increase of 20%, the sum must also demonstrate an absolute increase of at least 5 mm (Note: the appearance of one or more new lesions is also considered progressions);
Stable Disease (SD)—neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD, taking as reference the smallest sum diameters while on study.
FIG. 2 also shows the type of cancer or organ where the tumor burden was measured for each patient, and the type of atypical BRAF mutation identified in that patient's tumor sample. Of the 28 patients represented, 13 patient tumors comprised a BRAF D594 mutation (seven were D594G and six were D594N): 1 patient tumor comprised a BRAF F247L mutation: 1 patient tumor comprised a BRAF gene fusion with Nuclear Factor IC (NFIC) gene (i.e. BRAF-NFIC Fusion mutation): 1 patient tumor comprised a BRAF G466V mutation: 5 patient tumors comprised a BRAF G469 mutation (one was G469V and four were G469A): 3 patient tumors comprised a BRAF K601E mutation: 1 patient tumor comprised a BRAF L485W mutation: 3 patient tumors comprised a BRAF L597 mutation (one was undefined and two were L597Q), and 2 patient tumors comprised a T599 Duplication. Type of BRAF mutation is indicated by color code and by cancer type for each patient (See FIG. 2).
Five PR patients had between 35% to 100% reduction in the sum of target lesions from baseline. Those patients displayed: a gallbladder tumor comprising a L485W mutation; a squamous cell tumor of the head/neck comprising a G469A mutation; non-small cell lung carcinoma comprising a BRAF L597Q mutation or BRAF T599 duplication; and a tumor of the small intestine comprising a BRAF G469A mutation. Stable disease was demonstrated in 19 patients. Three patients displayed progressive disease at first evaluation. (See FIG. 2). Thus, BVD-523 treatment surprisingly resulted in partial response or stable disease in 24 out of 28 patients with atypical (i.e. non-V600E/K) BRAF mutations.
FIG. 3 shows duration of treatment in a Swimmer's plot categorized by group. Members of Group 1 are any patients with any BRAF mutation in any tumor type other than colorectal cancer (CRC) and non-small cell lung carcinoma (NSCLC), and that have not been previously treated with a MAPK pathway inhibitor. The members of Group 2 are patients with any BRAF mutation in CRC that have not been previously treated with a MAPK pathway inhibitor. The members of Group 3 are patients having a tumor with a BRAF V600E/K mutation that is refractory to MAPK inhibitor treatment. The members of Group 6 are patients with any BRAF mutation present in NSCLC. As shown in FIG. 3, all 28 patients are included as represented by the horizontal bars, one for each subject. The duration of treatment for each subject in each group is illustrated from the top (longest treatment duration) to bottom (least treatment duration) of the groups. The horizontal axis represents the duration, in days, that the patient was on the study. FIG. 3 also shows the type of response achieved for each patient according to RECIST v1.1 (diamond=partial response; circle=stable disease; vertical bar=progressive disease: triangle=not evaluated).
FIG. 4 shows duration of treatment in a waterfall plot broken down by BRAF mutation. All 28 patients measured for RECIST v1.1 response criteria are included, plus additional patients not evaluated by RECIST v1.1 (diamond=partial response; circle=stable disease: vertical bar=progressive disease; triangle=not evaluated). The mean duration of BVD-523 treatment before discontinuation for tumors harboring the same BRAF mutation was: D594, 73.6 days; G469, 208.14 days: K601E, 50.25 days: L597, 73.3 days; T599 Dup, 63.5 days. For single patient representatives of specific BRAF mutations, the duration of treatment was: L485W, 304 days: F247L, 84 days: G466V, 77 days: BRAF fusion, 65 days: BRAF-AGAP3 rearrangement, 43 days: BRAF exon 15 splice variant, 15 days. By genomic screening of cancer patients for BRAF mutation and treating them prior to full in vitro characterization of those mutations (as a driver mutation), BVD-523 is shown to be useful to interrogate and discover efficacious treatment options for patients carrying mutations in BRAF. The clinical population of patients and the efficacy is not defined primarily by tumor type, but rather mutational status of enzymes such as BRAF, upstream of ERK 1/2 kinase activation.
In summary, the provided examples present data from the solid tumor Phase 1b trial of BVD-523, a novel ERK inhibitor, as a treatment for patients with cancers harboring atypical BRAF mutations. Continuous, twice-daily treatment with BVD-523 resulted in antitumor effects in several patients, and was not limited to any one specific cancer type or atypical BRAF mutation.
DOCUMENTS
ABSALAN, Farnaz, Mostafa Ronaghi (2008). Molecular Inversion Probe Assay. Methods in Molecular Biology 396. Humana Press. pp. 315-330.
AHRONIAN L G, Sennott E M, Van Allen E M, Wagle N, Kwak E L, Faris J E, et al. Clinical acquired resistance to RAF inhibitor combinations in BRAF-mutant colorectal cancer through MAPK pathway alterations. Cancer Discov 2015:5:358-67.
ARCILA M E, Drilon A, Sylvester B E, Lovly C M, Borsu L, Reva B, et al. MAP2K1 (MEK1) mutations define a distinct subset of lung adenocarcinoma associated with smoking. Clin Cancer Res 2015:21:1935-43.
ARONOV A M, Baker C, Bemis G W, Cao J, Chen G, Ford P J, et al. Flipped out: structure-guided design of selective pyrazolylpyrrole ERK inhibitors. J Med Chem 2007:50:1280-7.
ARONOV A M, Tang Q, Martinez-Botella G, Bemis G W, Cao J, Chen G, et al. Structure-guided design of potent and selective pyrimidylpyrrole inhibitors of extracellular signal-regulated kinase (ERK) using conformational control. J Med Chem 2009:52:6362-8.
ARRINGTON A K, Heinrich E L, Lee W, Duldulao M, Patel S, Sanchez J, et al. Prognostic and predictive roles of KRAS mutation in colorectal cancer. Int J Mol Sci 2012:13:12153-68.
CARGNELLO M, Roux P P. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev 2011:75:50-83.
CARLINO M S, Fung C, Shahheydari H, Todd J R, Boyd S C, Irvine M, et al. Preexisting MEKIP124 mutations diminish response to BRAF inhibitors in metastatic melanoma patients. Clin Cancer Res 2015:21:98-105.
CHAPMAN P B, Hauschild A, Robert C, Haanen J B, Ascierto P, Larkin J, et al. Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med 2011; 364:2507-16.
CORCORAN, R. B., et al. BRAF gene amplification can promote acquired resistance to MEK inhibitors in cancer cells harboring the BRAF V600E mutation. Sci Signal (2010); 3 (149): ra84.
DAI, B., et al. STAT3 mediates resistance to MEK inhibitor through microRNA miR-17. Cancer Res (2011); 71:3658-3668.
DAVIES H, Bignell G R, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature 2002; 417:949-54.
DESCHENES-SIMARD X, Kottakis F, Meloche S, Ferbeyre G. ERKs in cancer: friends or foes? Cancer Res 2014; 74:412-9.
DOBRZYCKA B, Terlikowski S J, Kowalczuk O, Niklinska W, Chyczewski L, Kulikowski M. Mutations in the KRAS gene in ovarian tumors. Folia Histochem Cytobiol 2009:47:221-4.
EMERY, C. M., et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. PNAS (2009); 106 (48): 20411-6.
FEDOROV O, Niesen F H, Knapp S. Kinase inhibitor selectivity profiling using differential scanning fluorimetry. Methods Mol Biol 2012; 795:109-18.
FERNÁNDEZ-MEDARDE A, Santos E. Ras in cancer and developmental diseases. Genes Cancer 2011; 2:344-58.
FLAHERTY K T, Infante J R, Daud A, Gonzalez R, Kefford R F, Sosman J, et al. Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations. N Engl J Med 2012; 367:1694-703.
GOETZ E M, Ghandi M, Treacy D J, Wagle N, Garraway L A. ERK mutations confer resistance to mitogen-activated protein kinase pathway inhibitors. Cancer Res 2014; 74:7079-89.
GOLLOB J A, Wilhelm S, Carter C, Kelley S L. Role of Raf kinase in cancer: therapeutic potential of targeting the Raf/MEK/ERK signal transduction pathway. Semin Oncol 2006; 33:392-406.
GREGER, James G., et al. “Combinations of BRAF, MEK, and PI3K/mTOR inhibitors overcome acquired resistance to the BRAF inhibitor GSK2118436 dabrafenib, mediated by NRAS or MEK mutations.” Molecular cancer therapeutics 11.4 (2012): 909-920.
GROENENDIJK F H, Bernards R. Drug resistance to targeted therapies: deja vu all over again. Mol Oncol 2014:8:1067-83.
HALL R D, Kudchadkar R R. BRAF mutations: signaling, epidemiology, and clinical experience in multiple malignancies. Cancer Control 2014; 21:221-30.
HARDENBOL, P., et al. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nat. Biotechnol. 2003, no. 21, p. 673-678.
HATZIVASSILIOU, Georgia, et al. “RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth.” Nature 464.7287 (2010): 431-435.
HATZIVASSILIOU G, Liu B, O'Brien C, Spoerke J M, Hoeflich K P, Haverty P M, et al. ERK inhibition overcomes acquired resistance to MEK inhibitors. Mol Cancer Ther 2012; 11:1143-54.
HAUSCHILD A, Grob J-J, Demidov L V, Jouary T, Gutzmer R, Millward M, et al. Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, phase 3 randomised controlled trial. Lancet 2012:380:358-65.
HAYES T K, Neel N F, Hu C, Gautam P, Chenard M, Long B, et al. Long-Term ERK Inhibition in KRAS-Mutant Pancreatic Cancer Is Associated with MYC Degradation and Senescence-like Growth Suppression. Cancer Cell 2016; 29:75-89.
HEZEL A F, Noel M S, Allen J N, Abrams T A, Yurgelun M, Faris J E, et al. Phase II study of gemcitabine, oxaliplatin in combination with panitumumab in KRAS wild-type unresectable or metastatic biliary tract and gallbladder cancer. Br J Cancer 2014; 111:430-6.
JHA S, Morris E J, Hruza A, Mansueto M S, Schroeder G, Arbanas J, et al. Dissecting therapeutic resistance to ERK inhibition. Mol Cancer Ther 2016; 15:548-59.
JOHANNESSEN, C. M., et al. COT/MAP3K8 drives resistance to RAF inhibition through MAP kinase pathway reactivation. Nature (2010); 468 (7326): 968-972.
JOHNSON D B, Menzies A M, Zimmer L, Eroglu Z, Ye F, Zhao S, et al. Acquired BRAF inhibitor resistance: A multicenter meta-analysis of the spectrum and frequencies, clinical behaviour, and phenotypic associations of resistance mechanisms. Eur J Cancer 2015; 51:2792-9.
KANDA M, Matthaei H, Wu J, Hong S M, Yu J, Borges M, et al. Presence of somatic Mutations in most early-stage pancreatic intraepithelial neoplasia. Gastroenterology 2012; 142:730-733.
KHATTAK M, Fisher R, Turajlic S, Larkin J. Targeted therapy and immunotherapy in advanced melanoma: an evolving paradigm. Ther Adv Med Oncol 2013; 5:105-18.
KING, Alastair J., et al. “Dabrafenib; preclinical characterization, increased efficacy when combined with trametinib, while BRAF/MEK tool combination reduced skin lesions.” PloS one 8.7 (2013): e67583.
LARKIN J, Ascierto P A, Dreno B, Atkinson V, Liszkay G, Maio M, et al. Combined vemurafenib and cobimetinib in BRAF-mutated melanoma. N Engl J Med 2014; 371:1867-76.
LITTLE, A. S., et al., Amplification of the Driving Oncogene, KRAS or BRAF, Underpins Acquired Resistance to MEK1/2 Inhibitors in Colorectal Cancer Cells. Sci. Signal. 4, ral7 (2011).
LIU, Dingxie, et al. “BRAF V600E maintains proliferation, transformation, and tumorigenicity of BRAF-mutant papillary thyroid cancer cells.” Journal of Clinical Endocrinology & Metabolism 92.6 (2007): 2264-2271.
LIU B, Fu L, Zhang C, Zhang L, Zhang Y, Ouyang L, et al. Computational design, chemical synthesis, and biological evaluation of a novel ERK inhibitor (BL-EI001) with apoptosis-inducing mechanisms in breast cancer. Oncotarget 2015; 6:6762-75.
LONG G V, Fung C, Menzies A M, Pupo G M, Carlino M S, Hyman J, et al. Increased MAPK reactivation in early resistance to dabrafenib/trametinib combination therapy of BRAF-mutant metastatic melanoma. Nat Commun 2014; 5:5694.
LONG G V, Stroyakovskiy D, Gogas H, Levchenko E, de Braud F, Larkin J, et al. Dabrafenib and trametinib versus dabrafenib and placebo for Val600 BRAF-mutant melanoma: a multicentre, double-blind, phase 3 randomised controlled trial. Lancet 2015:386:444-51.
MANANDHAR S P, Hildebrandt E R, Schmidt W K. Small-molecule inhibitors of the Rcelp CaaX protease. J Biomol Screen. 2007; 12 (7): 983-993.
MASSEY P R, Prasad V, Figg W D, Fojo T. Multiplying therapies and reducing toxicity in metastatic melanoma. Cancer Biol Ther 2015; 16:1014-8.
MAURER, T, Garrenton, L S, Oh, A, Pitts, K, Anderson, D J, Skelton, N J, Fauber, B P, Pan, B, Malek, S, Stokoe, D, Ludlam, M J C, Bowman, K K, Wu, J, Giannetti, A M, Starovasnik, M A, Mellman, I, Jackson, P K, Rudolph, J, Wang, W, Fang, G. Small-molecule ligands bind to a distinct pocket in Ras and inhibit SOS-mediated nucleotide exchange activity. PNAS. 2012; 109 (14): 5299-304.
MCARTHUR G A, Chapman P B, Robert C, Larkin J, Haanen J B, Dummer R, et al. Safety and efficacy of vemurafenib in BRAFv600E and BRAFv600K mutation-positive melanoma (BRIM-3): extended follow-up of a phase 3, randomised, open-label study. Lancet Oncol 2014; 15:323-32.
MEKINIST [package insert]. Research Triangle Park, NC: GlaxoSmithKline; 2014.
METZKER, Emerging technologies in DNA sequencing Genome Res. 2005. 15:1767-1776.
MITTAL, Rohit et al. “The acetyltransferase activity of the bacterial toxin YopJ of Yersinia is activated by eukaryotic host cell inositol hexakisphosphate.” Journal of Biological Chemistry 285.26 (2010): 19927-19934.
MORRIS E J, Jha S, Restaino C R, Dayananth P, Zhu H, Cooper A, et al. Discovery of a novel ERK inhibitor with activity in models of acquired resistance to BRAF and MEK inhibitors. Cancer Discov 2013; 3:742-50.
NAZARIAN, R., et al. Melanomas acquire resistance to B-RAF (V600E) inhibition by RTK or N-RAS upregulation. Nature. 2010; 468 (7326): 973-977.
NIKOLAEV S I, Rimoldi D, Iseli C, Valsesia A, Robyr D, Gehrig C, et al. Exome sequencing identifies recurrent somatic MAP2K1 and MAP2K2 mutations in melanoma. Nat Genet 2012; 44:133-9.
NILSSON, M., et al. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science. 1994, no. 265, p. 2085-2088.
O'HARA A J, Bell D W. The genomics and genetics of endometrial cancer. Adv Genomics Genet 2012; 2012:33-47.
OJESINA A I, Lichtenstein L, Freeman S S, Pedamallu C S, Imaz-Rosshandler I, Pugh T J, et al. Landscape of genomic alterations in cervical carcinomas. Nature 2014; 506:371-5.
OTA et al., Single nucleotide polymorphism detection by polymerase chain reaction-restriction fragment length polymorphism. Nat Protoc. 2007; 2 (11): 2857-64.
PARAISO K H T, Fedorenko I V, Cantini L P, Munko A C, Hall M, Sondak V K, et al. Recovery of phospho-ERK activity allows melanoma cells to escape from BRAF inhibitor therapy. Br J Cancer 2010; 102:1724-30.
PATGIRI A, Yadav, K K, Arora, P S, Bar-Sagi, D. An orthosteric inhibitor of the Ras-Sos interaction. Nat Chem Biol. 2011; 7:585-587.
PENNYCUICK A, Simpson T, Crawley D, Lal R, Santis G, Cane P, et al. Routine EGFR and KRAS mutation analysis using COLD-PCR in non-small cell lung cancer. Int J Clin Pract 2012; 66:748-52.
PORTER S B, Hildebrandt E R, Breevoort S R, Mokry D Z, Dore T M, Schmidt W K. Inhibition of the CaaX proteases Rcelp and Ste24p by peptidyl (acyloxy)methyl ketones. Biochim Biophys Acta. 2007; 1773 (6): 853-862.
POULIKAKOS P I, Persaud Y, Janakiraman M, Kong X, Ng C, Moriceau G, et al. RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF (V600E). Nature 2011; 480:387-90.
QUEIROLO P, Picasso V, Spagnolo F. Combined BRAF and MEK inhibition for the treatment of BRAF-mutated metastatic melanoma. Cancer Treat Rev 2015; 41:519-26.
RASOLA A, Sciacovelli M, Chiara F, Pantic B, Brusilow W S, Bernardi P. Activation of mitochondrial ERK protects cancer cells from death through inhibition of the permeability transition. Proc Natl Acad Sci USA 2010; 107:726-31.
RIZOS H, Menzies A M, Pupo G M, Carlino M S, Fung C, Hyman J, et al. BRAF inhibitor resistance mechanisms in metastatic melanoma: spectrum and clinical impact. Clin Cancer Res 2014; 20:1965-77.
ROBERT C, Karaszewska B, Schachter J, Rutkowski P, Mackiewicz A, Stroiakovski D, et al. Improved overall survival in melanoma with combined dabrafenib and trametinib. N Engl J Med 2015; 372:30-9.
ROMEO Y, Zhang X, Roux P P. Regulation and function of the RSK family of protein kinases. Biochem J 2012; 441:553-69.
RUDOLPH J, Xiao Y, Pardi A, Ahn N G. Slow inhibition and conformation selective properties of extracellular signal-regulated kinase 1 and 2 inhibitors. Biochemistry 2015; 54:22-31.
SHAUL Y D, Seger R. The MEK/ERK cascade: from signaling specificity to diverse functions. Biochim Biophys Acta 2007; 1773:1213-26.
SHI H, Hugo W, Kong X, Hong A, Koya R C, Moriceau G, et al. Acquired resistance and clonal evolution in melanoma during BRAF inhibitor therapy. Cancer Discov 2014; 4:80-93.
SHIMA, F, Yoshikawa, Y, Ye, M, Araki, M, Matsumoto, S, Liao, J, Hu, L, Sugimoto, T, Ijiri, Y, Takeda, A, Nishiyama, Y, Sato, C, Muraoka, S, Tamura, A, Osoda, T, Tsuda, K-I, Miyakawa, T, Fukunishi, H, Shimada, J, Kumasaka, Yamamoto, M, Kataoka, T. In silico discovery of small-molecule Ras inhibitors that display antitumor activity by blocking the Ras-effector interaction. PNAS. 2013; 110(20):8182-7.
SCHUBBERT S, Shannon K, Bollag G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 2007; 7:295-308.
SUN C, Hobor S, Bertotti A, Zecchin D, Huang S, Galimi F, et al. Intrinsic resistance to MEK inhibition in KRAS mutant lung and colon cancer through transcriptional induction of ERBB3. Cell Rep 2014; 7:86-93.
TAFLINAR [package insert]. Research Triangle Park, NC: GlaxoSmithKline; 2015.
TRUNZER K, Pavlick A C, Schuchter L, Gonzalez R, McArthur G A, Hutson T E, et al. Pharmacodynamic effects and mechanisms of resistance to vemurafenib in patients with metastatic melanoma. J Clin Oncol 2013; 31:1767-74.
VILLANUEVA, J., et al. Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1R/PI3K. Cancer Cell. 2010; 18:683-695.
WAGLE, N., et al. Dissecting therapeutic resistance to RAF inhibition in melanoma by tumor genomic profiling. Journal of Clinical Oncology 2011; 29(22):3085-3096.
WAGLE N, Van Allen E M, Treacy D J, Frederick D T, Cooper Z A, Taylor-Weiner A, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer Discov 2014; 4:61-8.
Wainstein E, Seger R. The dynamic subcellular localization of ERK: mechanisms of translocation and role in various organelles. Curr Opin Cell Biol 2016; 39:15-20.
WANG, H., et al. Identification of the MEK1 (F129L) activating mutation as a potential mechanism of acquired resistance to MEK inhibition in human cancers carrying the B-RAF V600E mutation. Cancer Res (2011); 71(16):5535-45.
YANG W, Soares J, Greninger P, Edelman E J, Lightfoot H, Forbes S, et al. Genomics of Drug Sensitivity in Cancer (GDSC): a resource for therapeutic biomarker discovery in cancer cells. Nucleic Acids Res 2013; 41:D955-D961.
YAO Z, Torres N M, Tao A, Gao Y, Luo L, Li Q, et al. BRAF Mutants Evade ERK-Dependent Feedback by Different Mechanisms that Determine Their Sensitivity to Pharmacologic Inhibition. Cancer Cell 2015; 28:370-83.
YOHE S. Molecular genetic markers in acute myeloid leukemia. J Clin Med 2015; 4:460-78.
ZELBORAF [package insert]. South San Francisco, CA: Genentech USA, Inc.: 2015.
All documents cited in this application are hereby incorporated by reference as if recited in full herein.
Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to those described, and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the invention.Source: ipg260324.zip (2026-03-24)